Skip to main content

Table 2 Primer used for ChIP

From: Histone hypo-acetylation of Sox9 mediates nicotine-induced weak cartilage repair by suppressing BMSC chondrogenic differentiation

Transcript Sense primer Antisense primer Product Annea
Sox9(327~ 429) GCTCGGAACTGTCTGGAAAC GAAACCAGGGCTACTTGCAC 103 bp 60 °C
Col2A1(413~ 546) GCACCTAGGCGATCTGGTTA GAGCTGCTGGCTGACTCTTT 134 bp 60 °C
  1. Abbreviations: ChiP chromatin immunoprecipitation, Col2A1 α1 chain of type II collagen gene, Sox9 SRY-type high mobility group box 9