Skip to main content

Table 1 Primers of polymerase chain reaction for dog leukocyte antigen (DLA) genotyping

From: Allogeneic transplantation of mobilized dental pulp stem cells with the mismatched dog leukocyte antigen type is safe and efficacious for total pulp regeneration

Gene   5′–3′ DNA sequence
DLA-88 exon 1–3 Forward AGTCCAGCGGCGACGGCCAGTGTCCCCGGA
Reverse AGCCCTCCCTAGTGGAGGCGAGATCGGGGA
DLA-DQA exon 2 Forward TAAGGTTCTTTTCTCCCTCT
Reverse GG AC AG ATT C AGT G AAG AG A
DLA-DQB exon 2 Forward CTCACTGGCCCGGCTGTCTC
Reverse GGTGCGCTCACCTCGCCGCT
DLA-DRB exon 2 Forward GATCCCCCCGTCCCCACAG
Reverse TGTGTCACACACCTCAGCACCA