Skip to main content

Table 2 Canine primers for real-time reverse transcription-polymerase chain reaction for immunomodulatory factors

From: Allogeneic transplantation of mobilized dental pulp stem cells with the mismatched dog leukocyte antigen type is safe and efficacious for total pulp regeneration

Gene   5′–3′ DNA sequence Accession number Product (base pairs)
PTGES Forward GCCGCTGTGACTGTACC NM_001122854 190
Reverse TGGTCCAATCAGCCACTTC
COX-2 Forward GTTCATTCCTGATCCCCAAG NM_001003354 186
Reverse TTGAAAAGGCGCAGTTTATG
IL-6 Forward TCCAGAACAACTATGAGGGTGA NM_001003301.1 l00
Reverse TCCTGATTCTTTACCTTGCTCTT
TGF-β Forward CTGGAGTCGTGAGGCAGTG NM 0010033309.1 96
Reverse GCAGTGTGTTATCTTTGCTGTCA
IDO-1 Forward GGAAAGGCAACTCCAAACTG XM_532793 124
Reverse CCCAGCAGAATGTCAAAGC
β-actin Forward AAGTACCCCATTGAGCACGG Z70044 257
Reverse ATCACGATGCCAGTGGTGCG
  1. PTGES prostaglandin E synthase, COX-2 cyclooxygenase-2, IL interleukin, TGF transforming growth factor, IDO-1 indoleamine 2,3-dioxygenase 1.