Skip to main content

Table 1 Primers for quantitative real-time polymerase chain reaction

From: Long noncoding RNA H19 upregulates vascular endothelial growth factor A to enhance mesenchymal stem cells survival and angiogenic capacity by inhibiting miR-199a-5p

Gene name Forward primer (5′–3′) Reverse primer (5′–3′)
H19 GCTCCACTGACCTTCTAAAC ACGATGTCTCCTTTGCTAAC
MiR-199a-5p ACACTCCAGCTGGGCCCAGTGTTCAGACTACCT CTCAACTGGTGTCGTGGA
VEGFA AGATTCTGCAAGAGCACC AAGGTCCTCCTGAGCTAT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
β-actin GCTTCTAGGCGGACTGTTAC CCATGCCAATGTTGTCTCTT