Skip to main content

Table 1 List of primer sequences used in this study

From: Differentiation of adipose-derived stem cells into Schwann cell-like cells through intermittent induction: potential advantage of cellular transient memory function

Target genes Forward primer (5’–3’) Reverse primer(5’–3’) Annealing temperature (°C)
GAPDH ATGGTGAAGGTCGGTGTGAACG TTACTCCTTGGAGGCCATGTAG 55–62
P0 GCTCTTCTCTTCTTTGGTGCTGTCC GGCGTCTGCCGCCCGCGCTTCG 57
NGFR p75 ATGAGGAGGGCAGGTGCTG TCACACTGGGGACGTGGC 55
GFAP GGACATCGAGATCGCCACCTACAG CATCCCGCATCTCCACCGTCTTTAC 57
NGF ATGTCCATGTTGTTCTACAC TCAGCCTCTTCTTGCAGCC 56
BDNF ATGACCATCCTTTTCCTTAC CTATCTTCCCCTTTTAATGG 57
CNTF ATGGCTTTCGCAGAGCAAA CTACATCTGCTTATCTTTGGCC 56
  1. BDNF, brain-derived neurotrophic factor; CNTF, ciliary neurotrophic factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; NGF, nerve growth factor; NGFR p75, nerve growth factor receptor p75; P0, myelin protein zero