Skip to main content

Table 1 Primer sequences

From: Physioxia: a more effective approach for culturing human adipose-derived stem cells for cell transplantation

Gene Forward (5′ to 3′) Reverse (5′ to 3′)
HPRT CCTGACCAAGGAAAGCAAAG GACCAGTCAACAGGGGACAT
VEGF AGGGAAGAGGAGGAGATGAG GCTGGGTTTGTCGGTGTT
VEGFR2 CTGGCTACTTCTTGTCATCATCCTACG TGGCATCATAAGGCAGTCGTTCAC
vWF ACCTTGGTCACATCTTCACATTCACTC AAGTCATTGGCTCCGTTCTCATCAC
BNIP3 AGGGCTCCTGGGTAGAACTG ACTCCGTCCAGACTCATGCT
COX4I1 GCCATGTTCTTCATCGGTTT CATCCTCTTGGTCTGCTTGG
COX4I2 CCCTACACCAACTGCTATGC CTTCCCTTCTCCTTCTCCTTC
PDK1 AATCACACAGACGCCTAGCA CATCCTCTTGGTCTGCTTGG
LDHA ATCTTGACCTACGTGGCTTGGA CCATACAGGCACACTGGAATCTC
MCT4 ATCTGCTTTGCCATCTTTGC GTCCAGAAAGGACAGCCATC
NHE2 TTCATGCCACGGATAAATGA TTCTCTTCAGGCCAGCAAAT
NHE3 AGGTCCATGTCAACGAGGTC ACTATGCCCTTCACGCAGTC
CAR9 GTCTCGCTTGGAAGAAATCG ACAGGGCGGTGTAGTCAGAG
GLUT1 CATAGCCACCTCCTGGGATA AATCACACAGACGCCTAGCA
GLUT3 GCACATAGCTATCAAGTGTGC AGTGAGAAATGGGACCCTGC
PGM TGGAAATACGGAATGCTGAA GCTGCCTTTGATGGAGATG
GYS1 ACCCACCTTGTTAGCCACCT AACCGCACTTTGTCCATGTC
PYGL CCAAAGCAGCCACATCATC GCCCTAACTATCGGGACCAT