Skip to main content

Table 1 Polymerase chain reaction primer design

From: The establishment of a chemically defined serum-free culture system for human dental pulp stem cells

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
Runx2 GAAATGCCTCTGCTGTTATGAA CCGTTATGGTCAAAGTGAAACTC
OCN CCTCTCTCTGCTCACTCTGCTG ACCTTACTGCCCTCCTGCTTG
PPARγ TCCGAAGAACCATCCGATTGAA CCACAGCAAGGCACTTCTGA
MAP-2 GTGAGTGCAGATGCTGAGGT TGGCAATGGGACTGTGTACT
GAPDH TATGACTCTACCCACGGCAAG TACTCAGCACCAGCATCACC