Skip to main content

Table 1 Sequence of primers used for quantitative real-time polymerase chain reaction

From: Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells

Target name Direction Primer sequence (5′–3′) Size (base pairs)
OCT4 Forward ACCCCTGGTGCCGTGAA 190
Reverse GGCTGAATACCTTCCCAAATA
CD44 Forward AAGGTGGAGCAAACACAACC 151
Reverse AGCTTTTTCTTCTGCCCACA
COL1A1 Forward CCCCTGGAAAGAATGGAGATG 148
Reverse TCCAAACCACTGAAACCTCTG
COL1A2 Forward GGATGAGGAGACTGGCAACC 77
Reverse TGCCCTCAGCAACAAGTTCA
COL3A1 Forward CGCCCTCCTAATGGTCAAGG 161
Reverse TTCTGAGGACCAGTAGGGCA
Vimentin Forward GAGAACTTTGCCGTTGAAGC 170
Reverse TCCAGCAGCTTCCTGTAGGT
PAX6 Forward GTCCATCTTTGCTTGGGAAA 110
Reverse TAGCCAGGTTGCGAAGAACT
SOX1 Forward CACAACTCGGAGATCAGCAA 133
Reverse GGTACTTGTAATCCGGGTGC
Np63 Forward GGAAAACAATGCCCAGACTC 294
Reverse GTGGAATACGTCCAGGTGGC
KRT5 Forward ACCGTTCCTGGGTAACAGAGCCAC 198
Reverse GCGGGAGACAGACGGGGTGATG
KRT14 Forward GCAGTCATCCAGAGATGTGACC 181
Reverse GGGATCTTCCAGTGGGATCT
GAPDH Forward ACCCACTCCTCCACCTTTGA 110
Reverse CTGTTGCTGTAGCCAAATTCGT