Skip to main content

Table 1 Primers for real-time PCR

From: Mesenchymal stem cells alleviate experimental autoimmune cholangitis through immunosuppression and cytoprotective function mediated by galectin-9

Genes Primers
Forward (5‘-3’) Reverse (5‘-3’)
Human GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA
Human Galectin-1 AGGTTGTTGCTGTCTTTGCC CAAACCTGGAGAGTGCCTTC
Human Galectin-3 TGCAACCTTGAAGTGGTCAG GGGGAAGGGAAGAAAGACAG
Human Galectin-9 ATAGTCCCAGAAAAGGGGACA TCCTAGTGGGTGTGAAAGGC
Human CXCL10 GCTGATGCAGGTACAGCGT CACCATGAATCAAACTGCGA
Human CCL5 TGTACTCCCGAACCCATTTC TACACCAGTGGCAAGTGCTC
Human CCL20 CGTGTGAAGCCCACAATAAA GTGCTGCTACTCCACCTCTG
Human CX3CL1 ACGTGATGTTGCATTTCGTC CCGATATCTCTGTCGTGGCT
Mouse GAPDH TTGATGGCAACAATCTCCAC CGTCCCGTAGACAAAATGGT
Mouse IFN-γ ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC
Mouse IL-17A TTTAACTCCCTTGGCGCAAAA CTTTCCCTCCGCATTGACAC
Mouse IL-12 GCTTCTCCCACAGGAGGTTT CTAGACAAGGGCATGCTGGT
Mouse IL-23 GCTCCCCTTTGAAGATGTCA GACCCACAAGGACTCAAGGA
Mouse T-bet ATCCTGTAATGGCTTGTGGG TCAACCAGCACCAGACAGAG
Mouse RORγt GGTGATAACCCCGTAGTGGA CTGCAAAGAAGACCCACACC
Mouse CXCL10 CCTATGGCCCTCATTCTCAC CTCATCCTGCTGGGTCTGAG
Mouse CCL5 CCACTTCTTCTCTGGGTTGG GTGCCCACGTCAAGGAGTAT
Mouse CCL20 TGTACGAGAGGCAACAGTCG TCTGCTCTTCCTTGCTTTGG
Mouse CX3CL1 TGGGATTCGTGAGGTCATCT CGCGTTCTTCCATTTGTGTA