Skip to main content

Advertisement

Table 1 Primer sequences used for quantitative real-time polymerase chain reaction

From: miR-431 inhibits adipogenic differentiation of human bone marrow-derived mesenchymal stem cells via targeting insulin receptor substance 2

Gene Accession No. Forward (5′–3′) Reverse (5′–3′)
IRS2 NM_003749 CCACAGTTCCGAGACCTTCT TCGCTGCTTTTCCTGAGAGA
C/EBPα NM_004364 CCAAGAAGTCGGTGGACAAGAAC CACCTTCTGCTGCGTCTCCA
PPARγ NM_015869 GGGATGTCTCATAATGCCATCAG GCCCTCGCCTTTGCTTTG
GAPDH NM_002046 ACCCACTCCTCCACCTTTG CTCTTGTGCTCTTGCTGGG