Skip to main content

Table 2 Primers and experimental conditions used for qPCR analysis

From: Physiological cyclic hydrostatic pressure induces osteogenic lineage commitment of human bone marrow stem cells: a systematic study

Gene Tm (°C) Primer concentration (nM) Sequence PCR product size (bp)
18S 60 300 5′- ATCGGGGATTGCAATTATTC -3′ 130