Skip to main content

Advertisement

Table 2 Primers and experimental conditions used for qPCR analysis

From: Physiological cyclic hydrostatic pressure induces osteogenic lineage commitment of human bone marrow stem cells: a systematic study

Gene Tm (°C) Primer concentration (nM) Sequence PCR product size (bp)
18S 60 300 5′- ATCGGGGATTGCAATTATTC -3′ 130
3′- CTCACTAAACCATCCAATCG -5′
GAPDH 60 300 5′- ACAGTTGCCATGTAGACC -3′ 95
3′- TTTTTGGTTGAGCACAGG -5′
COX2 60 400 5′- GGAGAAAAGGAAATGTCTGC -3′ 186
3′- GTAGGCAGGAGAACATATAAC -5′
RUNX2 60 400 5′- GCAGTATTTACAACAGAGGG -3′ 112
3′- TCCCAAAAGAAGTTTTGCTG -5′
OPN 60 400 5′- GACCAAGGAAAACTCACTAC -3′ 84
3′- CTGTTTAACTGGTATGGCAC -5′