Skip to main content

Table 1 The primer sequences used for RT-qPCR

From: Characterization of embryonic stem cell-differentiated fibroblasts as mesenchymal stem cells with robust expansion capacity and attenuated innate immunity

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
β-actin CATGTACGTAGCCATCCAGGC CTCTTTGATGTCACGCACGAT
Runx2 GCCCAGGCGTATTTCAGA TGCCTGGCTCTTCTTACTGAG
OCN CTGACCTCACAGATGCCAAG GTAGCGCCGGAGTCTGTT
SOX9 AGTACCCGCATCTGCACAAC ACGAAGGGTCTCTTCTCGCT
Col2α1 GGGTCACAGAGGTTACCCAG ACCAGGGGAACCACTCTCAC
PPARγ GGAAGACCACTCGCATTCCTT GTAATCAGCAACCATTGGGTCA
C/EBPα CAAGAACAGCAACGAGTACCG GTCACTGGTCAACTCCAGCAC
CD106 CCAAATCCACGCTTGTGTTGA GGAATGAGTAGACCTCCACCT
CD105 AGGGGTGAGGTGACGTTTAC GTGCCATTTTGCTTGGATGC
CD73 CCTGCACACAAACGACGTG CTGGTCTCCGGCATCCAAAA
CD29 ATGCCAAATCTTGCGGAGAAT TTTGCTGCGATTGGTGACATT
CD44 TCGATTTGAATGTAACCTGCCG CAGTCCGGGAGATACTGTAGC
CD31 TGCACCCATCACTTACCACC CTTCATCCACCGGGGCTATC
CD34 CTGGGTAGCTCTCTGCCTGAT TGGTAGGAACTGATGGGGATATT
TNFα CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG
MHCI CCTTGGAGCTGCAATAGTC CTGGGAGAGACAGATCAGAG
MHCII CAACCGTGACTATTCCTTCC CTCAGGTTCCCAGTGTTTC
iNOS CAGCACAGGAAATGTTTCAGC TAGCCAGCGTACCGGATGA
CyclinD1 CAGAAGTGCGAAGAGGAGGTC TCATCTTAGAGGCCACGAACAT
CyclinE AATTGGGGCAATAGAGAAGAGGT TGGAGCTTATAGACTTCGCACA
CyclinA ACATTCACACGTACCTTAGGGA CATAGCAGCCGTGCCTACA
CyclinB CTCAGGGTCACTAGGAACACG AGCTCTTCGCTGACTTTATTACC
P16 CGCAGGTTCTTGGTCACTGT TGTTCACGAAAGCCAGAGCG
P21 CGAGAACGGTGGAACTTTGAC CAGGGCTCAGGTAGACCTTG
VEGF GGAGATCCTTCGAGGAGCACT GGCGATTTAGCAGCAGATATAA
SCF CCCTGAAGACTCGGGCCTA CAATTACAAGCGAAATGAGAGCC
TGFβ ATCCTGTCCAAACTAAGGCTCG ACCTCTTTAGCATAGTAGTCCGC
PDGF CATCCGCTCCTTTGATGATCTT GTGCTCGGGTCATGTTCAAGT
HGF ATGTGGGGGACCAAACTTCTG GGATGGCGACATGAAGCAG
SDF TGCATCAGTGACGGTAAACCA CACAGTTTGGAGTGTTGAGGAT
CTGF GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA
bFGF GCGACCCACACGTCAAACTA CCGTCCATCTTCCTTCATAGC
ICAM1 GGCATTGTTCTCTAATGTCTCCG GCTCCAGGTATATCCGAGCTTC
IL6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC
IL1α TCTATGATGCAAGCTATGGCTCA CGGCTCTCCTTGAAGGTGA