Skip to main content

Table 1 The list of primers used for q-RT PCR

From: The optimal time to inject bone mesenchymal stem cells for fracture healing in a murine model

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
SDF-1 AAACTGTGCCCTTCAGATTGTT CGGGGAACTAGTTTTTCCTTTT
TGFβ1 CAAGTGTGGAGCAACATGTGGAA ATCAGTGGGGGTCAGCAGCC
MCP3 TCTGTGCCTGCTGCTCATAG CTTTGGAGTTGGGGTTTTCA
GAPDH TGACATCAGAAGGTGGTGAAG ATCCTGTTGCTGTAGCCGTATT