Skip to main content

Table 1 The characteristics and primers of the nine circRNAs

From: Circular RNAs are abundantly expressed and upregulated during repair of the damaged endometrium by Wharton’s jelly-derived mesenchymal stem cells

Serial number circRNAs gene Sequence (5′- > 3′) (Forward/Reverse) Template strand Product length
1 hsa-circRNA8881-21 ASPM TGTCTCTTCTGTAAAGATGCCGAA Plus 92
ACCAATTCGAAGCCACAAAGGA Minus
2 hsa_circ_0020488 MKI67 CAGTGACCAGCCACAGGAGA Plus 188
CGACCCCGCTCCTTTTGATA Minus
3 hsa_circ_0020492 MKI67 AATCCATGAGCAGGAGGCAAT Plus 166
GGGGAAGGCCAGAAGCAAA Minus
4 hsa_circ_0026141 TROAP TAACCGCCATCCACTGCTTC Plus 178
GGGCGAGTGGAAGGGTGAAA Minus
5 hsa-circRNA4049-38 WDR62 GTTCCTCCGCCACCACTTTGA Plus 195
TCATGGGGGTAAAGTAGCAATCCA Minus
6 hsa_circ_0015825 KIF14 AGGGGTGAAGATGCCTTTTGTG Plus 164
GACCCTAAGCTCTTCTTTGGACAT Minus
7 hsa-circRNA5028-15 MYBL2 GAAAGTCCGGAAGTCTCTGGC Plus 171
GTGGTTGTGCCAGCGTTCA Minus
8 hsa_circ_0020487 MKI67 CTCTATCCCAGTGACCAGCCA Plus 145
ATTGCCTCCTGCTCATGGATTT Minus
9 hsa_circ_0111659 KIF14 GGCTGAGTGATTTACTGCCTTGT Plus 174
GGTCTTTTCCTGCAGAGGTGTT Minus
10   GAPDH GGACTCATGGTATGAGAGCTGG Plus 180
CAGCGTACTCCCCACATCAC Minus