Skip to main content

Table 2 The primers of the host genes

From: Circular RNAs are abundantly expressed and upregulated during repair of the damaged endometrium by Wharton’s jelly-derived mesenchymal stem cells

Serial number gene Sequence (5′- > 3′)
(Forward/Reverse)
Template strand Length
1 ASPM GAGCATTTCTGTCTGCAAAACATC Plus 24
   TTGCAGGCAGCTTTCACTTTAC Minus 22
2 MKI67 TTGTAAATTTGCTTCTGGCCTTC Plus 23
   ACGGATGTCACATTCAATACCC Minus 22
3 TROAP GGATCAGTCAGCCTCGGAAC Plus 20
   CAGGGTCAGCCACAAACTCT Minus 20
4 WDR62 TGAGAAGAGGGTGCTGGAGA Plus 20
   CCTGTGCCACGTCTACCC Minus 18
5 KIF14 GACTTCAGGGCCTCTCGG Plus 18
   GACCCTAAGCTCTTCTTTGGAC Minus 22
6 MYBL2 GAGGGATAGCAAGTGCAAGGT Plus 21
   TTCCAGTCCTGCTGTCCAAA Minus 20