Skip to main content

Table 1 Real-time PCR primer sequences

From: Stem cell library screen identified ruxolitinib as regulator of osteoblastic differentiation of human skeletal stem cells

Gene name Forward primer Reverse primer
ACTB 5′AGCCATGTACGTTGCTA 5′AGTCCGCCTAGAAGCA
ALP 5′GGA ACT CCT GAC CCT TGA CC3′ 5′TCC TGT TCA GCT CGT ACT GC3′
RUNX2 5′GTA GAT GGA CCT CGG GAA CC3′ 5′GAG GCG GTC AGA GAA CAA AC3′
COMP 5′CCGACACCGCCTGCGTTCTT3′ 5′AGCGCCGCGTTGGTTTCCTG3′
THBS2 5′TTGGCAAACCAGGAGCTCAG3′ 5′GGTCTTGCGGTTGATGTTGC3′
TNF 5′ACT TTG GAG TGA TCG GCC3′ 5′GCT TGA GGG TTT GCT ACA AC3′
LIF 5′GCCACCCATGTCACAACAAC 5′CCCCCTGGGCTGTGTAATAG
SOCS3 5′TTCGGGACCAGCCCCC3′ 5′AAACTTGCTGTGGGTGACCA3′