Skip to main content

Advertisement

Table 1 Primer sequences for qPCR

From: Targeted migration of bone marrow mesenchymal stem cells inhibits silica-induced pulmonary fibrosis in rats

Gene name Forward (5′-3′) Reverse (5′-3′)
Collagen I CAATGGCACGGCTGTGTGCG CACTCGCCCTCCCGTCTTTGG
Collagen III TGAATGGTGGTTTTCAGTTCAG GATCCCATCAGCTTCAGAGACT
FN TGACAACTGCCGTAGACCTGG TACTGGTTGTAGGTGTGGCCG
AQP-5 AAGGAGGTGTGCTCCCTTGCC TCAGTGTGCCGTCAGCTCGAT
SP-C GTCCTTGTCGTCGTGGTGAT AGGTAGCGATGGTGTCTGTGT
Sry CATCGAAGGGTTAAAGTGCCA ATAGTGTGTAGGTTGTTGTCC
β-Actin GTCAGGTCATCACTATCGGCAAT AGAGGTCTTTACGGATGTCAACGT
  1. qPCR quantitative real-time PCR, FN fibronectin, Sry sex-determining region Y, AQP-5 aquaporin-5, SP-C surfactant protein-C