Skip to main content

Table 1 Sequences of primers used for PCR

From: Recapitulation of methotrexate hepatotoxicity with induced pluripotent stem cell-derived hepatocytes from patients with rheumatoid arthritis

Target name Direction Primer sequence (5′–3′) Size (bp)
OCT3/4 Forward ACCCCTGGTGCCGTGAA 190
Reverse GGCTGAATACCTTCCCAAATA
SOX2 Forward CAGCGCATGGACAGTTAC 321
Reverse GGAGTGGGAGGAAGAGGT
NANOG Forward AAAGGCAAACAACCCACT 270
Reverse GCTATTCTTCGGCCAGTT
DPPA5 Forward CGGCTGCTGAAAGCCATTTT 215
Reverse AGTTTGAGCATCCCTCGCTC
LIN28 Forward GTTCGGCTTCCTGTCCAT 122
Reverse CTGCCTCACCCTCCTTCA
ALB Forward TTGGCACAATGAAGTGGGTA 161
Reverse AAAGGCAATCAACACCAAGG
CYP1A2 Forward ATGGCATTGTCCCAGTCTGTT 135
Reverse TGGCTCTGGTGGACTTTTCAG
CYP2D6 Forward GTGTCCAACAGGAGATCGACG 101
Reverse CACCTCATGAATCACGGCAGT
CYP2E1 Forward GTTCTTTGCGGGGACAGAGA 202
Reverse GAGGGTGATGAACCGCTGAA
CYP3A4 Forward TGTGCCTGAGAACACCAGAG 226
Reverse GTGGTGGAAATAGTCCCGTG
CYP3A7 Forward GAAACACAGATCCCCCTGAA 105
Reverse TCAGGCTCCACTTACGGTCT
UGT1A1 Forward CAGCAGAGGGGACATGAAAT 174
Reverse ACGCTGCAGGAAAGAATCAT
UGT2B15 Forward GTGTTGGGAATATTATGACTACAGTAAC 157
Reverse GGGTATGTTAAATAGTTCAGCCAGT
OATP1B1 Forward GAGCAACAGTATGGTCAGCCT 135
Reverse GGCAATTCCAACGGTGTTCA
OATP1B3 Forward GTCCAGTCATTGGCTTTGCA 111
Reverse CAACCCAACGAGAGTCCTTAGG
NTCP Forward GGGACATGAACCTCAGCATT 199
Reverse CGTTTGGATTTGAGGACGAT
MRP2 Forward AGCGTCCTCTGACACTCG 206
Reverse GGCATCTTGGCTTTGACT
MDR1 Forward CTAATGCCGAACACATTGGA 237
Reverse CAGTCGCTTTATTTCTTTGCC
AHR Forward CAAATCCTTCCAAGCGGCATA 123
Reverse CGCTGAGCCTAAGAACTGAAAG
FXR Forward CAGGATTTCAGACTTTGGACCAT 63
Reverse CTTCAACCGCAGACCCTTTC
GR Forward ATAGCTCTGTTCCAGACTCAACT 111
Reverse TCCTGAAACCTGGTATTGCCT
PPARα Forward AGAGATTTCGCAATCCATCGG 62
Reverse ACTGGTATTCCGTAAAGCCAAAG
RXRA Forward ATGGACACCAAACATTTCCTGC 211
Reverse GGGAGCTGATGACCGAGAAAG
SHP Forward CCCCAAGGAATATGCCTGCC 233
Reverse TAGGGCGAAAGAAGAGGTCCC
ADORA1 Forward GTCCTCATCCTCACCCAGAG 189
Reverse CAGATTGTTCCAGCCAAACA
ADORA2A Forward CGAGGGCTAAGGGCATCATTG 98
Reverse CTCCTTTGGCTGACCGCAGTT
ADORA2B Forward CTCTTCCTCGCCTGCTTCGTG 107
Reverse TTATACCTGAGCGGGACACAG
ADORA3 Forward TACATCATTCGGAACAAACTC 80
Reverse GTCTTGAACTCCCGTCCATAA
CD39 Forward ACAGGCGTGGTGCATCAAGTAGAA 279
Reverse CCTGGCACCCTGGAAGTCAAAG
CD73 Forward CAGTACCAGGGCACTATCTG 194
Reverse AGTGGCCCCTTTGCTTTAAT
GAPDH Forward GAATGGGCAGCCGTTAGGAA 414
Reverse GACTCCACGACGTACTCAGC