Skip to main content

Table 1 Primers used in this study for qRT-PCR

From: Exosomes secreted by endothelial progenitor cells accelerate bone regeneration during distraction osteogenesis by stimulating angiogenesis

Genes Forward primer (5′-3′) Reverse primer (5′-3′)
h-VEGFA CGCTCGGTGCTGGAATTTGA AGTGGGGAATGGCAAGCAAA
h-bFGF CAATTCCCATGTGCTGTGAC ACCTTGACCTCTCAGCCTCA
h-TGFB1 TTGAGGGCTTTCGCCTTAGC TGAACCCTGCGTTGATGTCC
h-ANG ACACTTCCTGACCCAGCACT TGTTTTCACAGATGGCCTTG
h-GAPDH ATCCCATCACCATCTTCC GAGTCCTTCCACGATACCA