Skip to main content

Table 1 Primers for qPCR, ChIP, and MSP

From: OCT4 maintains self-renewal and reverses senescence in human hair follicle mesenchymal stem cells through the downregulation of p21 by DNA methyltransferases

Gene Forward primers (5′ to 3′) Reverse primers (5′ to 3′)
OCT4 CTGAAGCAGAAGAGGATCAC GACCACATCCTTCTCGAGCC
p21 TGGAGACTCTCAGGGTCGAAA GGCGTTTGGAGTAGAAATC
p16 GTGGACCTGGCTGAGGAG CTTTCAATCGGGGATGTCTG
hTERT CATGGGCACGTCCGCAA GGCGTGGTGGCACATGAA
DNMT1 ACCGCTTCTACTTCCTCGAGGCCTA GTTGCAGTCCTCTGTGAACACTGTGG
DNMT3a CACACAGAAGCATATCCAGGAGTG AGTGGACTGGGAAACCAAATACCC
DNMT3b AATGTGAATCCAGCCAGGAAAGGC ACTGGATTACACTCCAGGAACCGT
GAPDH CCATGTTCGTCATGGGTGTGA CATGGACTGTGGTCATGAGT
DNMT1 (ChIP) CCCCACACACTGGGTATAGAA CGAGGCATTCATTCATTCATT
DNMT3a (ChIP) TCATTTCATTCAACCTCCCAC CTCTGAGATGAGCTGCCTTGA
DNMT3b (ChIP) CATCCAAAGAATTAACCCTTCACT GGTCTCCAAGTGCTTATAGTGGAT
p21 U (MSP) TTTTGGGATTGGTTGGTTTG ACACCCAACTCCAACTCCAC
p21 M (MSP) TTGTAGTACGCGAGGTTTCG CAACTCAACGCGACCCTAAT