Skip to main content

Advertisement

Table 2 Quantitative PCR primer sequences

From: Human liver stem cells attenuate concanavalin A-induced acute liver injury by modulating myeloid-derived suppressor cells and CD4+ T cells in mice

Gene Sequence (5′-3′) Product (bp)
GAPDH F: CTAGAGAGCTGACAGTGGGTAT 49
R: AGACGACCAATGCGTCCAAA
TNF-α F: CCCTCACACTCAGATCATCTTCT 61
R: GCTACGACGTGGGCTACAG
IFN-γ F: TCGGTAACTGACTTGAATGTCCA 93
R: TCGCTTCCCTGTTTTAGCTGC
IL-10 F: TCAAGGCGCATGTGAACTCC 176
R: GATGTCAAACTCACTCATGGCT