Skip to main content

Advertisement

Table 1 Primer sequences for qRT-PCR

From: Exosomes from glioma cells induce a tumor-like phenotype in mesenchymal stem cells by activating glycolysis

Gene Forward primer sequence Reverse primer sequence
P21 GGATTGGTTGGTTTGTTGGAATTT ACAACCCTAATATACAACCACCCC
P16 AACGCACCGAATAGTTACGG CACCAGCGTGTCCCAGGAAG
MMP-2 TATGGCTTCTGCCCTGAGAC CACACCACATCTTTCCGTCA
MMP-9 AGTCCACCCTTGTGCTCTTC ACTCTCCACGCATCTCTGC
GFAP GATCAACTCACCGCCAACAG AGGTTGTTCTCG GCTTCC AG
CD133 ACAATTCACCAGCAACGAGTCC GACGCTTTGGTATAGAGTGCTCA
Nestin GGG AGTCCGATGGGTTTG GGC TCCCAACAGAAGACC
Glut-1 CTTTGTGGCCTTCTTTGAAGT CCACACAGTTGCTCCACAT
PKM-2 GGGTTCGGAGGTTTGATG ACGGCGGTGGCTTCTGT
HK-2 TGCCAAGCGTCTCCATAA GGTCAGCCAGACGGTAA
GAPDH GCACCGTCAAGGCTGAGAAC ATGGTGGTGAAGACGCCAGT