Skip to main content

Table 2 Sequences of oligonucleotide primers used to amplify the listed mRNA species, and PCR product sizes

From: Mesenchymal stem cell-loaded porous tantalum integrated with biomimetic 3D collagen-based scaffold to repair large osteochondral defects in goats

Target gene Primer sequence Annealing temperature (°C) Product size (bp)
ALP F:tacttgtgcggggtgaagg 60 144
R:cacgatgcccacggattt
OSX F:ggcaaagcaggcacaaaga 60 184
R:ctgggaacgagtgggaaaag
OCN F:cagcgaggtggtgaagaga 60 144
R:tggaagccgatgtggtcag
Col-I F:tggtgaagcaggcaaacct 60 87
R:aaacctctctcgcctcttgct
OSN F:tcgactcttcctgccacttct 60 200
R:gttgtcctcgtccctctcgt
RUNX2 F:ccgaaatgcctctgctgtt 60 87
R:aaactcttgcctcttccactcc
Col-II F:ctcaagtccctcaacaaccaga 60 123
R:ccagtagtctccgctcttcca
Agg F:cctcaccatcccctgctactt 60 119
R:gcaccacctccttctccttg
SOX9 F:caagttccccgtctgcatc 60 111
R:tgcggcttgttcttgctc
Col-X F:gaacggcacccctgtaatgt 60 99
R:tggtcgttctcggtgaggt
GAPDH F:ttgtgatgggcgtgaacc 60 127
R:ccctccacgatgccaaa