Skip to main content

Table 1 Gene-primer sequences for RT-qPCR

From: Intraarticular senescent chondrocytes impair the cartilage regeneration capacity of mesenchymal stem cells

Name Forward primer Reverse Primer
Bax CATGGAGCTGCAGAGGATGA GAGGAAGTCCAGTGTCCAGC
Bcl-2 GAACTGGGGGAGGATTGTGG ACAAAGGCATCCCAGCCTC
CDKN2A CGTACCCCGATACAGGTGATG ATACCGCAAATACCGCACGA
CDKN1A AGCAGTTGAGCCGCGATTG ACCCAGGGCTCAGGTAGATCTTG
IL-6 CTCCGCAAGAGACTTCCAGC TCTGACAGTGCATCATCGCT
MMP1 ATGAGACGTGGACCGACAAC TGAGTGAGTCCAAGGGAGTG
MMP13 GCAGCTCCAAAGGCTACAAC TCTGGTGTTTTGGGGTGCTT
Sox9 CTGAAGGGCTACGACTGGAC CTCTCGTTCAGCAGTCTCCA
IL-1β GGCTTCCTTGTGCAAGTGTC TGTCGAGATGCTGCTGTGAG
COLL II GCCAGGATGCCCGAAAATTAG CATGACTCCCATCTGGGCAC
Nanog TTGGGCTGACATGAGCGTG GAGGAGAGGCAGTCTCTGTG
Oct-4 CACGAGTGGAGAGCAACTCG AGATGGTTGTCTGGCTGAAC