Skip to main content

Advertisement

Table 1 Primer sequences for reverse transcription-polymerase chain reaction

From: Feasibility of repairing full-thickness skin defects by iPSC-derived epithelial stem cells seeded on a human acellular amniotic membrane

Gene name Forward primer (5′–3′) Reverse primer (5′–3′)
OCT4 GACAGGGGGAGGGGAGGAGCTAGG CCTCCCTCCAACCAGTTGCCCCAAAC
SOX2 GGGAAATGGAGGGGTGCAAAAGAGG TTGCGTGAGTGTGGATGGGATTGGTG
KLF4 GAGGGAAGACCAGAATTCCCTTGA AGAAC AA ACTCACCAAGCACCA
c-MYC TGCACTGGAACTTACAA ACCCGA TAA GCA GCT GCA AGG AGA GCCTTT
LGR5 GAGTTACGTCTTGCGGGAAAC TGGGTACGTGTCTTAGCTGATTA
LGR6 AGCCCTGTGAGTACCTCTTTG CAGCACCAGTCCATTGCAGA
TCF4 CAAGCACTGCCGACTACAATA CCAGGCTGATTCATCCCACTG
CD200 ACAGCCCATAGTATCCCTTCAC GATGCTGGTAACAGACGTGGT
ITGA6 ATGCACGCGGATCGAGTTTG TTCCTGCTTCGTATTAACATGC
FZD2 GTGCCATCCTATCTCAGCTACA CTGCATGTCTACCAAGTACGTG
DKK3 ACGAGTGCATCATCGACGAG GCAGTCCCTCTGGTTGTCAC
CTNNB1 AAAGCGGCTGTTAGTCACTGG CGAGTCATTGCATACTGTCCAT
LEF1 TGCCAAATATGAATAACGACCCA GAGAAAAGTGCTCGTCACTGT
LHX2 ATGCTGTTCCACAGTCTGTCG GCATGGTCGTCTCGGTGTC
KRT14 TGAGCCGCATTCTGAACGAG GCAGTAGCGACCTTTGGTCT
KRT15 GACGGAGATCACAGACCTGAG CTCCAGCCGTGTCTTTATGTC
KRT19 ACCAAGTTTGAGACGGAACAG CCCTCAGCGTACTGATTTCCT
NANOG AAGGTCCCGGTCAAGAAACAG ATCCCTGCGTCACACCATTGC
REXO1 CCCTCCGTCCACATTTCCG GCGATTCGCTTAGGGATGATG