Skip to main content

Table 1 Primer sequences for quantitative real-time reverse transcription PCR

From: Fibronectin precoating wound bed enhances the therapeutic effects of autologous epidermal basal cell suspension for full-thickness wounds by improving epidermal stem cells’ utilization

Gene Direction Sequence 5′ → 3′
Tumor necrosis factor-α (TNF-α) Forward CATCCGTTCTCTACCCAGCC
Interleukin-8 (IL-8) Forward TCCACTCCCAGCATCGTAGA
Interleukin-10 (IL-10) Forward CTTCGGCCCAGTGAAGAGTT
Keratin 15 (K15) Forward GCTTGCTAGGGACCCGAAG
Cluster of differentiation 31 (CD31) Forward CTCCATCCTGTCGGGTAACG
Matrix metallopeptidase 9 (MMP-9) Forward CGCCAACTATGACCAGGATA
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Forward AGACAGCCGCATCTTCTTGT