Skip to main content

Advertisement

Table 1 Primer sequences for quantitative real-time reverse transcription PCR

From: Fibronectin precoating wound bed enhances the therapeutic effects of autologous epidermal basal cell suspension for full-thickness wounds by improving epidermal stem cells’ utilization

Gene Direction Sequence 5′ → 3′
Tumor necrosis factor-α (TNF-α) Forward CATCCGTTCTCTACCCAGCC
Reverse AATTCTGAGCCCGGAGTTGG
Interleukin-8 (IL-8) Forward TCCACTCCCAGCATCGTAGA
Reverse CAGAGTAAAGGGCGGGTCAG
Interleukin-10 (IL-10) Forward CTTCGGCCCAGTGAAGAGTT
Reverse TGGAGCTTGCTAAAGGCACT
MKI 67 (Ki-67) Forward GGAGGGTTTCCAGACACCAG
Reverse ACTTGCCCTAGACTGTCTCTCT
Keratin 15 (K15) Forward GCTTGCTAGGGACCCGAAG
Reverse CTCGGGTAGAGCCACTTCCA
Cluster of differentiation 31 (CD31) Forward CTCCATCCTGTCGGGTAACG
Reverse TTCTTCGTGGAAGGGTCTGC
Matrix metallopeptidase 9 (MMP-9) Forward CGCCAACTATGACCAGGATA
Reverse GTTGCCCCCCCAGTTACAGT
Collagen I (Col I) Forward GTACATCAGCCCAAACCCCA
Reverse CAGGATCGGAACCTTCGCTT
Collagen III (Col III) Forward ATATGTGTCTGCGACTCGGG
Reverse GGGCAGTCTAGTGGCTCATC
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Forward AGACAGCCGCATCTTCTTGT
Reverse TGATGGCAACAATGTCCACT