Skip to main content

Advertisement

Table 1 Primers sequences used in the real-time PCR

From: The potential application of concentrated growth factor in pulp regeneration: an in vitro and in vivo study

Gene Forward primer Reverse primer
IL-6 GGTGTTGCCTGCTGCCTTCC GTTCTGAAGAGGTGAGTGGCTGTC
IL-8 CAAGCTGGCCGTGGCTCTC GGTCCACTCTCAATCACTCTCAGTTC
IL-1β TGGCTTATTACAGTGGCAATGAGGATG TGTAGTGGTGGTCGGAGATTCGTAG
TNF-α CGTGGAGCTGGCCGAGGAG AGGAAGGAGAAGAGGCTGAGGAAC
DSPP GGAGCCACAAACAGAAGCAACA TGGACAACAGCGACATCCTCAT
DMP1 CAGGAAGAGGTGGTGAGTGAGT TGGATTCGCTGTCTGCTTGCT
Runx2 TCCAGACCAGCAGCACTCCATA TCCATCAGCGTCAACACCATCA
OPN TGCTACAGACGAGGACATCACC TCTGGACTGCTTGTGGCTGTG
OCN CCGCAGCTCCCAACCACAAT GCCAGCCTCCAGCACTGTTTA
GAPDH CCAGAACATCATCCCTGCCTCT GACGCCTGCTTCACCACCTT