Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences

From: Effect of canonical NF-κB signaling pathway on the differentiation of rat dental epithelial stem cells

Gene Primer forward (5-3) Primer reverse(5-3)
AMBN CTGCTCCTGTTCCTGTCCCTA GCTTCCCAACTGTCTCATTGTC
MMP20 GCCTTGCTGTCCTTGTCAC GAGGTGGTAGTTGCTCCTGAAG
KLK4 CCGAACTACAATGACCCTTCTT TCAGATGCTACCGAGAGATTCA
SMAD7 CCTCCTTACTCCAGATACCC ATTCGGACAA CAAGAGTCAG
GAPDH TATGACTCTACCCACGGCAAG TACTCAGCACCAGCATCACC