Skip to main content

Advertisement

Table 1 Primer sequences

From: Effect of canonical NF-κB signaling pathway on the differentiation of rat dental epithelial stem cells

Gene Primer forward (5-3) Primer reverse(5-3)
AMBN CTGCTCCTGTTCCTGTCCCTA GCTTCCCAACTGTCTCATTGTC
MMP20 GCCTTGCTGTCCTTGTCAC GAGGTGGTAGTTGCTCCTGAAG
KLK4 CCGAACTACAATGACCCTTCTT TCAGATGCTACCGAGAGATTCA
SMAD7 CCTCCTTACTCCAGATACCC ATTCGGACAA CAAGAGTCAG
GAPDH TATGACTCTACCCACGGCAAG TACTCAGCACCAGCATCACC