Skip to main content

Table 1 Primers for TFs (OCT4, SOX2, NANOG) and ecto-, endo-, and mesoderm genes by RT-PCR

From: Effect of ectopic high expression of transcription factor OCT4 on the “stemness” characteristics of human bone marrow-derived mesenchymal stromal cells

Gene Primer sequence (5′-3′) Products (bp)
GAPDH For: GAAGGTGAAGGTCGGAGTC 226
Rev: GAAGATGGTGATGGGATTTC
OCT4-I For: CGGGCTGATGGGCAAGTT 247
Rev: GGGCAGGAAGGATGGGTAA
OCT4-II For: CGCAAGCCCTCATTTCAC 1143
Rev: GGCAGGCACCTCAGTTTG
NANOG For: TTTTCCAGTCCACCTCTT 1022
Rev: GAAGGATTCAGCCAGTGT
SPARC For: CCTGATGAGACAGAGGTGGTGG 349
Rev: GCTTGTGGCCCTTCTTGGTG
TBX20 For: AAGGAGGCGACGGAGAACA 289
Rev: TCCTGCCCGACTTGGTGAT
TUBB3 For: AGCTCAACGCTGACCTGC 499
Rev: GCCTCGGTGAACTCCATCT
WNT1 For: CCGATGGTGGGGTATTGTG 500
Rev: TCATGAGGAAGCGCAGGTC
Brachyury For: AAGAACGGCAGGAGGATG 373
Rev: TCTCAGGGAAGCAGTGGC
Sox2 For: ATGGACAGTTACGCGCACAT 268
Rev: GACTTGACCACCGAACCCAT