Skip to main content

Table 1 Primer sequences used for quantitative real-time PCR

From: Hedgehog pathway inhibition causes primary follicle atresia and decreases female germline stem cell proliferation capacity or stemness

Genes Primer Sequence(5′-3′) Gene number
Gli1 Forward: CCCAATACATGCTGGTGGTG
Reverse: GCAACCTTCTTGCTCACACA
NM_010296.2
PTCH1 Forward: TGTGCGCTGTCTTCCTTCTG
Reverse: ACGGCACTGAGCTTGATTC
NM_001328514.1
CyclinD1 Forward: GATGAGGAAGAGTTGCTAGAAGAG
Reverse: TCGTCAGCCAATCGGTAGTAG
NM_007631.2
Mvh Forward: GTGTATTATTGTAGCACCAACTCG
Reverse: CACCCTTGTACTATCTGTCGAACT
NM_001145885.1
Oct-4 Forward: AGCTGCTGAAGCAGAAGAGG
Reverse: GGTTCTCATTGTTGTCGGCT
NM_013633.3
Stella Forward: CCCAATGAAGGACCCTGAAAC
Reverse: AATGGCTCACTGTCCCGTTCA
NM_139218.1
Fragilis Forward: CTGGTCCCTGTTCAATACACTCTT
Reverse: CAGTCACATCACCCACCATCTT
NM_025378.2
Nanog Forward: TCTCCTCGCCCTTCCTCTGA
Reverse: TCCGCATCTTCTGCTTCCTG
NM_001289828.1
Bcl-2 Forward: GAACTGGGGGAGGATTGTGG
Reverse: GCATGCTGGGGCCATATAGT
NM_009741.5
Bax Forward: GAACCATCATGGGCTGGACA
Reverse: AGCCACCCTGGTCTTGGAT
NM_007527.3
P16 Forward: AAGGCTTTGAGAGCCCATCT
Reverse: CACTTCTGTGAACGGTGTCC
NM_001040654.1
P21 Forward: TAGAGAGCTGGATGCCACTG
Reverse: CCTGGCATAGCCAGTGTAGA
NM_001111099.2
GAPDH Forward: CGTGCCGCCTGGAGAAACCTG
Reverse: AGAGTGGGAGTTGCTGTTGAAGTCG
NM_001289726.1