Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for qPCR validation

From: Therapeutic effects of human umbilical cord mesenchymal stem cell-derived microvesicles on premature ovarian insufficiency in mice

Gene Primer FW Primer RW
VEGF CAGGCTGCTGTAACGATGAA GCTTTGGTGAGGTTTGATCC
IGF-1 GACCGAGGGGCTTTTACTTC CATCCACAATGCCTGTCTGA
Angiogenin CCAGGCCCGTTGTTCTTGAT GGAAGGGAGACTTGCTCATTC