Skip to main content

Advertisement

Table 1 Primers used for qPCR validation

From: Therapeutic effects of human umbilical cord mesenchymal stem cell-derived microvesicles on premature ovarian insufficiency in mice

Gene Primer FW Primer RW
VEGF CAGGCTGCTGTAACGATGAA GCTTTGGTGAGGTTTGATCC
IGF-1 GACCGAGGGGCTTTTACTTC CATCCACAATGCCTGTCTGA
Angiogenin CCAGGCCCGTTGTTCTTGAT GGAAGGGAGACTTGCTCATTC