Skip to main content

Advertisement

Table 1 Primer information

From: Exosomes derived from mesenchymal stem cells reverse EMT via TGF-β1/Smad pathway and promote repair of damaged endometrium

Gene namePrimer nameSequence (5′ → 3′)
TGF-β1TGF-β1-FAACACAGCAGAGTGGTTGTC
TGF-β1-RTGTCCAGGCTCCAGATGTA
TGF-βR1TGF-βR1-FGATTTGGAGAAGTTTGGCG
TGF-βR1-RTCCCAGAATACTAAGCCCAT
Smad2Smad2-FCAGGAAGAGAAGTGGTGTGA
Smad2-RATACTGGAGGCAGAACTGGT
CK19rabbit-CK19-FGCGAACAGCCACTACTTCA
rabbit-CK19-RGTCTCAAACTTGGTTCGGA
VIMrabbit-VIM-FCGTTGACAATGCTTCTTTGG
rabbit-VIM-RTGGATTTCCTCATCGTGC
FSP-1rabbit-FSP1-FGGGAAAGAGGGTGACAAGTT
rabbit-FSP1-RGTCCAAGTTGCTCATCAGC
E-cadherinrabbit-Ecadherin-FACCCAGGTCTTCTACAGCAT
rabbit-Ecadherin-RGATGTGTTCTCGGTCCAGA
GAPDHGAPDH-FCTTTGGTATCGTGGAAGGA
GAPDH-RAGGGATGATGTTCTGGAGAG