Skip to main content

Table 1 Sequences of primers

From: Human placenta-derived mesenchymal stem cells ameliorate orbital adipogenesis in female mice models of Graves’ ophthalmopathy

Gene Sequences (5′ → 3′)
ADIPONECTIN F: GGCCGTGATGGCAGAGAT
R: TTTCACCGATGTCTCCCTTAGG
PPARγ F: TTGACCCAGAAAGCGATTCC
R: AAAGTTGGTGGGCCAGAATG
C/EBPα F: TGTATACCCCTGGTGGGAGA
R: TCATAACTCCGGTCCCTCTG
C/EBPβ F: CTTCAGCCCGTACCTGGAG
R: GGAGAGGAAGTCGTGGTGC
TGFβ2 F: TGGTGAAAGCAGAGTTCAGAG
R: CACAACTTTGCTGTCGATGTAG
CSH1 F: AAACTCGCACAACCATGACG
R: GAGGGGTCACAGGATGCTACTC
18 s rRNA F: TGAGAAACGGCTACCACATC
R: ACTACGAGCTTTTTAACTGC