Skip to main content

Advertisement

Table 1 The primers used for PCR amplification

From: Genotyping, generation and proteomic profiling of the first human autosomal dominant osteopetrosis type II-specific induced pluripotent stem cells

No. Target Sequence Product sizes (bp)
1 CLCN7 F: ACCCAGACCACGTCAGAAAG 411
R: GACTCGGTTGTCCTGAAAGC
2 SeV F: GGA TCA CTA GGT GAT ATC GAG C 181
R: ACC AGA CAA GAG TTT AAG AGA TAT GTA TC
3 KOS F: ATG CAC CGC TAC GAC GTG AGC GC 528
R: ACC TTG ACA ATC CTG ATG TGG
4 Klf4 F: TTC CTG CAT GCC AGA GGA GCC C 410
R: AAT GTA TCG AAG GTG CTC AA
5 c-Myc F: TAA CTG ACT AGC AGG CTT GTC G 532
R: TCC ACA TAC AGT CCT GGA TGA TGA TG
6 OCT4 F: CCTCACTTCACTGCACTGTA 164
R: CCTCACTTCACTGCACTGTA
7 GATA4 F: GACAATCTGGTTAGGGGAAGC 105
R: GAGAGATGCAGTGTGCTCGT
8 MSX1 F: TGCCTCGCTCTACGGTGCCT 154
R: GGCTGGAGGAATCGGCTGGC
9 SOX1 F: TTTCCCCTCGCTTTCTCA 104
R: TGCAGGCTGAATTCGGTT
10 GAPDH F: GGAGCGAGATCCCTCCAAAAT 197
R: GGCTGTTGTCATACTTCTCATGG
  1. Note: F forward primer, R reverse primer