Skip to main content

Table 1 Primer sequences used in quantitative and reverse transcriptase PCR assays

From: Nanofibrillar cellulose wound dressing supports the growth and characteristics of human mesenchymal stem/stromal cells without cell adhesion coatings

Gene primer sequence 5′-3′
CD73 F: CTTAACGTGGGAGTGGAACC
R: TCTAGCTGCCATTTGCACAC
CD90 F: CGCTCTCCTGCTAACAGTCTT
R: CAGGCTGAACTCGTACTGGA
CD105 F: CTAACTGGCAGGGGAGACAG
R: CTCCATGTGGCAGGAGCTA
CD166 F: ATTGAAGTTTTATTTGGCAGGAA
R: GGCTTAGCCATGCAAAACA
CD34 F: TCTGGATCAAAGTAGGCAGGA
R: GATCCAGCCTCAGAGGAAGA
CD45 F: GCAAAGATGCCCAGTGTTCCACTT
R: ATCTGAGGTGTTCGCTGTGATGGT
CCND1 F: TATTGCGCTGCTACCGTTGA
R: CCAATAGCAGCAAACAATGTGAAA
OCT4 F: CAGTGCCCGAAACCCACAC
R: GGAGACCCAGCAGCCTCAAA
SOX2 F: CTCCGGGACATGATCAGC
R: GGTAGTGCTGGGACATGTGAA
NANOG F: GCAGAAGGCCTCAGCACCTA
R: GGTTCCCAGTCGGGTTCAC
PPARγ F: TCAGCGGGAAGGACTTTATGTATG
R: TCAGGTTTGGGCGGATGC
RUNX2 F: GTCTTACCCCTCCTACCTGA
R: TGCCTGGCTCTTCTTACTGA
COL2A1 F: CGTCCAGATGACCTTCCTACG
R: TGAGCAGGGCCTTCTTGAG
FGF2 F: ATGGCAGCCGGGAGCATCACCCACG
R: TCAGCTCTTCGCAGACATTGGAAG
TNF-α F: ATGAGCACTGAAAGCATGATCC
R: GAGGGCTGATTAGAGAGAGGTC
VEGF F: TGCTTCTGAGTTGCCCAGGA
R: TGGTTTCAATGGTGTGAGGACATAG
IL-6 F: AACCTGAACCTTCCAAAGATGG
R: TCTGGCTTGTTCCTCACTACT
β-2-m F: CTCGCGCTACTCTCTCTTTCTG
R: GCTTACATGTCTCGATCCCACT