Skip to main content

Table 1 List of the primers used for PCR

From: Investigation of stemness and multipotency of equine adipose-derived mesenchymal stem cells (ASCs) from different fat sources in comparison with lipoma

Primer Forward Reverse Product size
CD105 CCGCCGCACTGTGGTACATCTAC TGTGGTTGGTGCTACTGCTCTCTG 108
CD90 CCCGTGGGCAGAAGGTGAC TCAGGCTGAACTCATACTGGATGG 112
CD44 CAGAACCAACCCTGAAGACATC GAAGGTGGGTGTGGAAGATG 116
CD45 GTTACGTTGACATCCTTCCTTA GCAATGTATTTCCTGGGTTCTTTG 127
ALP GACTGGTACTCGGACAACGAG GTTCTTGGGGAACATGTACTTC 137
BMP2 CAACACGGTGCGCAGCTTC CGCCGGGTTGTTTTTCCAC 74
Aggre CCTCATCGGAAACCTATGATGTCT GTTGTGGGACCCACAGAACTC 122
COMP GCAGGACTCAGACAGCGATGG GGCACCAGGCGGCAGTTG 96
Col2a1 CTGCCCATCATTGACATTGCAC GTCCACACCAAATTCCTGCTC 63
FABP4 ATCAGTGTAAACGGGGATGTG GACTTTTCTGTCATCCGCAGTA 117
LEP CGAAAAGTCCAGGATGACAC AACCAGTGACCCTCTGTTTG 106
PPARĪ³ GTCTCATAACGCCATCAGGTTTG GCCCTCGCCTTCGCTTTG 180
OP TGATCCTACTGATGACCCTGAC ATACGTGTCTCTTGTGGGCAC 136
CA9 TGCAACTGCTGCTGTTACTG TCTTCCCCAGATGAATCTCC 103
GAPDH CCAGCAAGAGAAGGAGAAAGG AACTGTGGAGGTCAGGAGAC 93
18S ATGCGGCGGCGTTATTCC GCTATCAATCTGTCAATCCTGT 204