Skip to main content

Table 2 Primer sequences used in this study

From: Glucose regulates tissue-specific chondro-osteogenic differentiation of human cartilage endplate stem cells via O-GlcNAcylation of Sox9 and Runx2

Primer for RT-PCR
Gene symbol Primer sequences (5′ to 3′)
GAPDH-Fa CTCTCTGCTCCTCCTGTTCG
GAPDH-Rb TTAAAAGCAGCCCTGGTGAC
Sox9-F TTTGCTTGTTCACTGCAGTCTTAAG
Sox9-R GGCATCTGCCTTCCACATG
COL2-F GCTCCCAGAACATCACCTACCA
COL2-R AACAGTCTTGCCCCACTTACCG
AGN-F CACGATGCCTTTCACCACGAC
AGN-R TGCGGGTCAACAGTGCCTATC
Runx2-F TACAGTAGATGGACCTCGGGAAC
Runx2-R GCGGGACACCTACTCTCATACTG
COL1-F CACAGAGGTTTCAGTGGTTTGG
COL1-R ACCATCATTTCCACGAGCA
ALP-F CAAAGGCTTCTTCTTGCTGG
ALP-R GGTCAGAGTGTCTTCCGAGG
OCN-F CGCCTGGGTCTCTTCACTAC
OCN-R CTCACACTCCTCGCCCTATT
  1. Fa forward, Rb reverse