Skip to main content

Table 1 Primer sequences used for reverse transcription-polymerase chain reaction

From: LncRNA KLF3-AS1 in human mesenchymal stem cell-derived exosomes ameliorates pyroptosis of cardiomyocytes and myocardial infarction through miR-138-5p/Sirt1 axis

Name of primersSequences
miR-138-5p-FGGCCGGACTAAGTGTTGT
miR-138-5p-RGCAGGGTCCGAGGTATTC
U6-FCTCGCTTCGGCAGCACATATACT
U6-RACGCTTCACGAATTTGCGTGTC
KLF3-AS1-FCTGTAGGCGCGCTCTTTCTTT
KLF3-AS1-RTCCGACCAAAGTTTGCCAAG
β-actin-FTGAGCTGCGTTTTACACCCT
β-actin-RGTTTGCTCCAACCAACTGCT
Sirt1-FGTGCAGGTAGTTCCTCGGTG
Sirt1-RCACAACTCACAGCATGCACAA
caspase-1-FTAGCTCATTCATCCGTCGGC
caspase-1-RCACGGTCCCAACAACCGATA
ASC-FTGGAGGACCTGGAGCGGAGC
ASC-RCAAGCTGGCTTTTCGTATATTGT
GSDMD-FGGCAACTTCCAAGTCTCCGA
GSDMD-RAGTCACACGCAGCATACACA
NLRP3-FCGGAGAGGTCGTTGGTTCAA
NLRP3-RTGGCTTTGTGTGAAAAATCCATA
  1. F forward, R reverse