Skip to main content

Table 2 List of primers used in eRNA studies

From: Epigenetic regulation of IFITM1 expression in lipopolysaccharide-stimulated human mesenchymal stromal cells

Name Forward sequence Reverse sequence
IFITM1_R1_S1 CCTAGAGCAGGAAATAGCGGT TTAAATAGCGCCTGCCCCGT
IFITM1_R1_AS1 CTGGCGCTGACCGCTATTTC AAAGACGTAGCTCCTTCTGGG
IFITM1_R1_S2 TCAGAATCTTGCATCCTCCA CTGGCTTCTAACCTCCAAGC
IFITM1_R1_AS2 ACAAGCCCCCTTCCTACCT CCACATGAGCAAGATTGTGG
IFITM1_R1_S3 ACTGCAGCCTGAGGAAAGAG CAGGACAATCCCCCAAAAG
IFITM1_R1_AS3 AGTGTCTCCTGGTGCAGGTC GCCTAGGTCATCCAGCACTC
IFITM1_R1_S4 CTGTGTTGGGGGTCTCCAC CCTGGGCACCACAGTGAG
IFITM1_R1_AS4 CAGGACCCCACACCACTAAC AAATCGGGATTTGGCCGGG
IFITM1_R1_S5 TTTCACTTCCAGCCGTTAAAA GGTGACTTTGGACTCAGCAG
IFITM1_R1_AS5 CTGGAAGAGGTGGCAGTGAT TGGGCAAACCAAGACTTTTC
IFITM1_R1_S6 GGCAAGGACGGTTGACTTCT GAGTGTCCAGGAAGCTGCG
IFITM1_R1_AS6 GAGTGTCCAGGAAGCTGCG AGGCAAGGACGGTTGACTTC