Skip to main content

Table 1 Oligonucleotide sequences used for RT-PCR analysis

From: Priming with inflammatory cytokines is not a prerequisite to increase immune-suppressive effects and responsiveness of equine amniotic mesenchymal stromal cells

MarkersSequences (5′➔3′)Product size (bp)Annealing temperature (°C)
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)S: AGATCAAGAAGGTGGTGAAG
A: TTGTCATACCAGGAAATGAGC
16860
Major histocompatibility complex I (MHC-I)S: GGAGAGGAGCAGAGATACA
A: CTGTCACTGTTTGCAGTCT
21855
Major histocompatibility complex II (MHC-II)S: TCTACACCTGCCAAGTG
A: CCACCATGCCCTTTCTG
17855