Skip to main content

Table 1 Primers for PCR and qRT-PCR

From: Loss of receptor tyrosine kinase-like orphan receptor 2 impairs the osteogenesis of mBMSCs by inhibiting signal transducer and activator of transcription 3

GeneForwardReverseApplication
Prrx1GCG GTC TGG CAG TAA AAA CTA TCGTG AAA CAG CAT TGC TGT CAC TTPCR
Ror2TGC AGG TTT TGA GCC CTA ACCGA GAA TGA CTT CCC TGT CCPCR
GAPDHCCTTCCGTGTTCCTACCCCAACCTGGTCCTCAGTGTAGqRT-PCR
Ror2ACGCAATGTGCTGGTGTACTGTCAGAGTCGATGGAGAACqRT-PCR
Stat3CATCCTGAAGCTGACCCAGGTATTGCTGCAGGTCGTTGGTqRT-PCR
Runx2CCGTCACCTCCATCCTCTTTCAATACGCATCACAACAGCCACAqRT-PCR
OSXACCCTTCCCTCACTCATTTCCTGTGCCTTGTACCACGAGCCATAGqRT-PCR
OPNCTCCAATCGTCCCTACAGTCGCCAAGCTATCACCTCGGCCqRT-PCR
COL1A1CCCAAGGAAAAGAAGCACGTCACATTAGGCGCAGGAAGGTCAqRT-PCR
OCNGCTGCCCTAAAGCCAAACTCTAGAGGACAGGGAGGATCAAGTTCqRT-PCR