Skip to main content

Table 1 Primers for PCR and qRT-PCR

From: Loss of receptor tyrosine kinase-like orphan receptor 2 impairs the osteogenesis of mBMSCs by inhibiting signal transducer and activator of transcription 3

Gene Forward Reverse Application
Prrx1 GCG GTC TGG CAG TAA AAA CTA TC GTG AAA CAG CAT TGC TGT CAC TT PCR
Ror2 TGC AGG TTT TGA GCC CTA AC CGA GAA TGA CTT CCC TGT CC PCR
GAPDH CCTTCCGTGTTCCTACCC CAACCTGGTCCTCAGTGTAG qRT-PCR
Ror2 ACGCAATGTGCTGGTGTAC TGTCAGAGTCGATGGAGAAC qRT-PCR
Stat3 CATCCTGAAGCTGACCCAGG TATTGCTGCAGGTCGTTGGT qRT-PCR
Runx2 CCGTCACCTCCATCCTCTTTC AATACGCATCACAACAGCCACA qRT-PCR
OSX ACCCTTCCCTCACTCATTTCCTG TGCCTTGTACCACGAGCCATAG qRT-PCR
OPN CTCCAATCGTCCCTACAGTCG CCAAGCTATCACCTCGGCC qRT-PCR
COL1A1 CCCAAGGAAAAGAAGCACGTC ACATTAGGCGCAGGAAGGTCA qRT-PCR
OCN GCTGCCCTAAAGCCAAACTCT AGAGGACAGGGAGGATCAAGTTC qRT-PCR