Skip to main content

Table 1 Primer sequence information

From: Low-intensity pulsed ultrasound upregulates osteogenesis under inflammatory conditions in periodontal ligament stem cells through unfolded protein response

GeneForward primer sequence (5′-3′)Reverse primer sequence (5′-3′)
IL-6AAGGTGGGTGTGTCCTCATTCTTGCATCCCTGAGTTGTCCAG
IL-8TGGACCCCAAGGAAAACTGGGCTTGAAGTTTCACTGGCATCT
GRP78TGCCCATCTCTGGAAGCCTACCGCAGTCAAGATGCCAAAC
IRE1αAGCCGTGGTGAAGATGGACTTCTCATGGCTCGGAGGAGAT
ATF4CGTCCTCGGCCTTCACAATAACCTCACGAAAGGAGAGAGGTG
CHOPTTCTCTGGCTTGGCTGACTGTCCTCCTCTTCCTCCTGAGC
XBP1uGTTAAGACAGCGCTTGGGGATGCACGTAGTCTGAGTGCTG
XBP1sCTGAGTCCGCAGCAGGTGGTCCAGAATGCCCAACAGGA
GAPDHAGCCGCATCTTCTTTTGCGTCTCATATTTGGCAGGTTTTTCT