Skip to main content

Table 1 Primers used for RT-qPCR

From: Comparison of senescence-related changes between three- and two-dimensional cultured adipose-derived mesenchymal stem cells

GenePrimer sequence (5′–3′)Product size (bp)
β-actinForward: CATGTACGTTGCTATCCAGGC250
Reverse: CTCCTTAATGTCACGCACGAT
P16Forward: ATCATCAGTCACCGAAGG369
Reverse: TCAAGAGAAGCCAGTAACC
P21Forward: CATCTTCTGCCTTAGTCTCA163
Reverse: CACTCTTAGGAACCTCTCATT
P53Forward: CGGACGATATTGAACAATGG158
Reverse: GGAAGGGACAGAAGATGAC
SOX2Forward: GCCGAGTGGAAACTTTTGTCG155
Reverse: GGCAGCGTGTACTTATCCTTCT
OCT4Forward: CTGGGTTGATCCTCGGACCT243
Reverse: CCATCGGAGTTGCTCTCCA
NanogForward: TCTATAACTGTGGAGAGGAATC122
Reverse: GGTCTGCTGTATTACATTAAGG
c-mycForward: GTCAAGAGGCGAACACACAAC162
Reverse: TTGGACGGACAGGATGTATGC
TERTForward: AAATGCGGCCCCTGTTTCT76
Reverse: CAGTGCGTCTTGAGGAGCA