Skip to main content

Table 1 The sequences of forward and reverse primers

From: CCL1 blockade alleviates human mesenchymal stem cell (hMSC)-induced pulmonary fibrosis in a murine sclerodermatous graft-versus-host disease (Scl-GVHD) model

GeneForward sequence (5′-3′)Reverse sequence (5′-3′)
Col1α1CAGTCGATTCACCTACAGCACGGGGATGGAGGGAGTTTACACG
Col1α2GGAGGGAACGGTCCACGATGAGTCCGCGTATCCACAA
Col3α1GTTCTAGAGGATGGCTGTACTAAACACATTGCCTTGCGTGTTTGATATTC
CCL1CGTGTGGATACAGGATGTTGACAGAGGAGGAGCCCATCTTTCTGTAAC
CCL2CTCACCTGCTGCTACTCATTCGCTTGAGGTGGTTGTGGAAAA
CCL3ACTGCCTGCTGCTTCTCCTACAAGGAAAATGACACCTGGCTGG
CCL5TGCCCACGTCAAGGAGTATTTCAACCCACTTCTTCTCTGGGTTG
CCL8TCTACGCAGTGCTTCTTTGCCAAGGGGGATCTTCAGCTTTAGTA
CCL17ACCGCTCATCTGTGCAGACCCGCCTGTAGTGCATAAGAGTCC
CCL22AAGACAGTATCTGCTGCCAGGGATCGGCACAGATATCTCGG
CCR4GCTTGGTCACGTGGTCAGTGGTGGTTGCGCTCCGTGTAG
CCR8CAGATAATTGGTCTTCCTGCCTCTGAGGAGGAACTCTGCGTCACA
β-ActinAGCTGCGTTTTACACCCTTTAAGCCATGCCAATGTTGTCT