Skip to main content

Table 1 Primers used for qPCR of human genes

From: Intermittent parathyroid hormone (1–34) supplementation of bone marrow stromal cell cultures may inhibit hypertrophy, but at the expense of chondrogenesis

Gene Sequence (5′ to 3′) Amplicon size (bp)
ACAN F: TCGAGGACAGCGAGGCC
R: TCGAGGGTGTAGCGTGTAGAGA
85
COL1A1 F: CAGCCGCTTCACCTACAGC
R: TTTTGTATTCAATCACTGTCTTGCC
83
COL2A1 F: GGCAATAGCAGGTTCACGTACA
R: CGATAACAGTCTTGCCCCACTT
79
RPLP0 F: TGTGGGCTCCAAGCAGATGCA
R: GCAGCAGTTTCTCCAGAGCTGGG
137
COL10A1 F: ACTCCCAGCACGCAGAATCCA
R: TGGGCCTTTTATGCCTGTGGGC
132
RUNX2 F: GGAGTGGACGAGGCAAGAGTTT
R: AGCTTCTGTCTGTGCCTTCTGG
133
SOX9 F: ACTCCTCCTCCGGCATGAG
R: GCTGCACGTCGGTTTTGG
102
IHH F: ATGAAGGCAAGATCGCTCG
R: GATAGCCAGCGAGTTCAGG
149
BGLAP/PB-OST F: GAAGCCCAGCGGTGCA
R: CACTACCTCGCTGCCCTCC
70