Skip to main content

Table 2 The sequence of primer used for RT-PCR in this study

From: MicroRNA-503-3p affects osteogenic differentiation of human adipose-derived stem cells by regulation of Wnt2 and Wnt7b under cyclic strain

Gene Accession No. 5′-3′ Tm (°C)
RUNX2 NM_001015051 F: TAGATAGTGATTGCGTTTGGCTATG 60
R: CACTAAGAAATGTTTCAAGGGTCC 60
ALP NM_003064 F: GAAAGTCCTTCAAAGCTGGAGTCT 60
R: TCTGGCACTCAGGTTTCTTGTATC 60
SPARC NM_001309443 F: TGTGATCTAAATCCACTCCTTCCA 60
R: ACAAACCATCCAAACATTTTAAACA 60
Wnt2 NM_004185 F: GGGGCACGAGTGATCTGTG 62
R: GCATGATGTCTGGGTAACGCT 62
Wnt7b NM_058238 F: CACAGAAACTTTCGCAAGTGG 60
R: GTACTGGCACTCGTTGATGC 60
β-catenin XM_024453360 F: TTGAACTGTTTGAGGCGAAGAG 60
R: ACTGAACACCGAGTTAGAGGAAT 60
GAPDH NM_001256799.2 F: GAACGGGAAGCTCACTGG 60
R: GCCTGCTTCACCACCTTCT 60