Skip to main content

Table 1 Primers for qRT-PCR and oligonucleotide

From: Correction to: Roles of microRNA-34a targeting SIRT1 in mesenchymal stem cells

Name   Sequence
Quantitative RT-PCR
 miR-34a   5′-UGGCAGUGUCUUAGCUGGUUGUU-3’
 SIRT1 Forward 5′-AAGGCCACGGATAGGTCCATA-3’
Reverse 5′-CGCTTTGGTGGTTCTGAAAGG-3’
 FOXO3a Forward 5′-TGCCGATGGGTTGGATTT-3′
Reverse 5′-CCAGTGAAGTTCCCCACGTT-3′
 U6 Forward 5′-CCTGCTTCGGCAGCACA-3’
Reverse 5′-AACGCTTCACGAATTTGCGT-3’
 β-actin Forward 5′- CCCAGCACAATGAAGATCAAGATCAT −3’
Reverse 5′- ATCTGCTGGAAGGTGTACAGCGA − 3’
Oligonucleotide
 miR-34a mimic   UGGCAGUGUCUUAGCUGGUUGUU CAACCAGCUAAGACACUGCCAUU
 NC mimic   UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
 miR-34a inhibitor   UGGCAGUGUCUUAGCUGGUUGUU
 NC inhibitor   CAGUACUUUUGUGUAGUACAA
 siRNA-SIRT1   GCACCGAUCCUCGAACAAUTT AUUGUUCGAGGAUCGGUGCTT
 siRNA-NT   UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT