Skip to main content

Table 1 Oligonucleotide primer sequences for qRT-PCR

From: SIRT1-modified human umbilical cord mesenchymal stem cells ameliorate experimental peritoneal fibrosis by inhibiting the TGF-β/Smad3 pathway

Gene Primer direction Sequence (5′–3′)
Fibronectin (human) Forward GCTTCCAAGTTGATGCCGTTC
Reverse CCGAGCATTGTCATTCAAGGTG
SIRT1 (human) Forward AAAGGAATTGGTTCATTTATCAGAG
Reverse TTGTGGTTTTTCTTCCACACA
Coll III (human) Forward ATGAAGGTGAATTCAAGGCTGAAG
Reverse CCACCAATGTCATAGGGTGCAATA
α-SMA (human) Forward ATAGAACATGGCATCATCACCAAC
Reverse GGGCAACACGAAGCTCATTGTA
Snail (human) Forward CCAGACCCACTCAGATGTCAAG
Reverse GGGCAGGTATGGAGAGGAAGA
E-cadherin (human) Forward CGAGAGCTACACGTTCACGG
Reverse GGGTGTCGAGGGAAAAATAGG
GAPDH (human) Forward GCACCGTCAAGGCTGAGAAC
Reverse TGGTGAAGACGCCAGTGGA
Fibronectin (rat) Forward CATCAGCCCGGATGTCAGAA
Reverse GGCATTGTCGTTGAGCGTGTA
Coll III (rat) Forward TTTGGCACAGCAGTCCAATGTA
Reverse GACAGATCCCGAGTCGCAGA
α-SMA (rat) Forward AGCCAGTCGCCATCAGGAAC
Reverse GGGAGCATCATCACCAGCAA
Snail (rat) Forward GCACTGTGATGCCCAGGCTA
Reverse CCTTGCCACAGATCTTGCAGAC
Calretinin (rat) Forward CACAGACAGAAGTGGCTACATCGAA
Reverse TGCCGTCTCCATTTAAGTCAAACA
IL-6 (rat) Forward CCCAACTTCCAATG CTCTCCTAATG
Reverse GCACACTAGGTTTGCCGAGTAGACC
IL-1β (rat) Forward TGTGATGTTCCCATTAGAC
Reverse AATACCACTTGTTGGCTTA
TNF-α (rat) Forward TCGGTCCCAACAAGGAGGAGAAGT
Reverse TGATCTGAGTGTGAGGGTCTGGGC
MCP-1 (rat) Forward AGGTCTCTGTCACGCTTCTGGG
Reverse TAGCAGCAGGTGAGTGGGGCAT
SIRT1 (rat) Forward GAAAATGCTGGCCTAATAGACTTG
Reverse TGGTACAAACAAGTATTGATTACCG
TGF-β (rat) Forward ATGGTGGACCGCAACAACGCAAT
Reverse CAGCTCTGCACGGGACAGCAAT
GAPDH (rat) Forward GTATTGGGCGCCTGGTCACC
Reverse CGCTCCTGGAAGATGGTGATGG