Skip to main content

Table 1 Primers sequences for HIF-1α amplification

From: HIF-1α overexpression in mesenchymal stem cell-derived exosomes mediates cardioprotection in myocardial infarction by enhanced angiogenesis

Forward primer (5′–3′) CGGAATTCGCCACCATGGAGGGCGCCGGCGGCGA
Reverse primer (5′–3′) CGGGATCCTCAGTTAACTTGATCCAAAGCTCTG