Skip to main content

Table 2 Primers sequences for RT-qPCR

From: HIF-1α overexpression in mesenchymal stem cell-derived exosomes mediates cardioprotection in myocardial infarction by enhanced angiogenesis

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
GAPDH ATGACTCTACCCACGGCAAG GGAAGATGGTGATGGGTTTC
Hif-1α AGCAATTCTCCAAGCCCTCC TTCATCAGTGGTGGCAGTTG
VEGF GGGAGCAGAAAGCCCATGAA AGATGTCCACCAGGGTCTCA
Ang-1 CACGACAGACCAGTACAACACAAACG GACGACTGTTGTTGGTGGTAGCTCT
PDGF CCGCTCCTTTGATGACCTTC GCTCAGCCCCATCTTCGTC